SOLVED: Find the promoter region on this DNA strand and highlight it (0.5 TII)AGATCCAAAATATTATATTACACCGGGCTTTATACTExplain why it makes sense that this is the promoter region. (0.5 TII)Identify the start and stop codons DNA and from the appropriate location, transcribe this DNA strand into the primary transcript: (2 TII)AGATCCAAAATATTATATTACACCGGGCTTTATACTBegin at the start codon (including it) and translate the segment above into a polypeptide: (1 TII)Considering how we second letter transcribed